ID: 985827049

View in Genome Browser
Species Human (GRCh38)
Location 5:2200262-2200284
Sequence CTCAGTTACCCCCTCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985827038_985827049 30 Left 985827038 5:2200209-2200231 CCAGCTTTGGCCCAATAGACCGT No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data
985827045_985827049 -8 Left 985827045 5:2200247-2200269 CCAGATGTCCCACACCTCAGTTA No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data
985827044_985827049 -7 Left 985827044 5:2200246-2200268 CCCAGATGTCCCACACCTCAGTT No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data
985827041_985827049 20 Left 985827041 5:2200219-2200241 CCCAATAGACCGTGTCTTGGGCA No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data
985827042_985827049 19 Left 985827042 5:2200220-2200242 CCAATAGACCGTGTCTTGGGCAA No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data
985827043_985827049 11 Left 985827043 5:2200228-2200250 CCGTGTCTTGGGCAAATTCCCAG No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985827049 Original CRISPR CTCAGTTACCCCCTCATGAA TGG Intergenic
No off target data available for this crispr