ID: 985829378

View in Genome Browser
Species Human (GRCh38)
Location 5:2216767-2216789
Sequence CAGTGTTTCCATGAGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985829373_985829378 -5 Left 985829373 5:2216749-2216771 CCCCTTGGAAGGGTTCTCCAGTG No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data
985829372_985829378 2 Left 985829372 5:2216742-2216764 CCTCTGTCCCCTTGGAAGGGTTC No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data
985829366_985829378 26 Left 985829366 5:2216718-2216740 CCCTGCTGGGCCAAGATTCAGTT No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data
985829375_985829378 -7 Left 985829375 5:2216751-2216773 CCTTGGAAGGGTTCTCCAGTGTT No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data
985829365_985829378 30 Left 985829365 5:2216714-2216736 CCTTCCCTGCTGGGCCAAGATTC No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data
985829368_985829378 16 Left 985829368 5:2216728-2216750 CCAAGATTCAGTTGCCTCTGTCC No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data
985829367_985829378 25 Left 985829367 5:2216719-2216741 CCTGCTGGGCCAAGATTCAGTTG No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data
985829374_985829378 -6 Left 985829374 5:2216750-2216772 CCCTTGGAAGGGTTCTCCAGTGT No data
Right 985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985829378 Original CRISPR CAGTGTTTCCATGAGCAGGC AGG Intergenic
No off target data available for this crispr