ID: 985829892

View in Genome Browser
Species Human (GRCh38)
Location 5:2220571-2220593
Sequence CTTGTATGGTGACCAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985829884_985829892 14 Left 985829884 5:2220534-2220556 CCCTTGACAGCATGTCAGGGAAG No data
Right 985829892 5:2220571-2220593 CTTGTATGGTGACCAAGCCCTGG No data
985829885_985829892 13 Left 985829885 5:2220535-2220557 CCTTGACAGCATGTCAGGGAAGG No data
Right 985829892 5:2220571-2220593 CTTGTATGGTGACCAAGCCCTGG No data
985829880_985829892 28 Left 985829880 5:2220520-2220542 CCCAGGCTGTGGCACCCTTGACA No data
Right 985829892 5:2220571-2220593 CTTGTATGGTGACCAAGCCCTGG No data
985829881_985829892 27 Left 985829881 5:2220521-2220543 CCAGGCTGTGGCACCCTTGACAG No data
Right 985829892 5:2220571-2220593 CTTGTATGGTGACCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985829892 Original CRISPR CTTGTATGGTGACCAAGCCC TGG Intergenic
No off target data available for this crispr