ID: 985836128

View in Genome Browser
Species Human (GRCh38)
Location 5:2273153-2273175
Sequence CCTTCGCAGGAAAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985836121_985836128 25 Left 985836121 5:2273105-2273127 CCTTTTTTCTCTCGCTCTCTTTT No data
Right 985836128 5:2273153-2273175 CCTTCGCAGGAAAGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985836128 Original CRISPR CCTTCGCAGGAAAGGCTGGA GGG Intergenic
No off target data available for this crispr