ID: 985836130

View in Genome Browser
Species Human (GRCh38)
Location 5:2273184-2273206
Sequence CACCGCATGCAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985836130_985836140 24 Left 985836130 5:2273184-2273206 CCCTCCACCCTCTGCATGCGGTG No data
Right 985836140 5:2273231-2273253 TAAGGGCCAGACGCCATCCCCGG No data
985836130_985836137 6 Left 985836130 5:2273184-2273206 CCCTCCACCCTCTGCATGCGGTG No data
Right 985836137 5:2273213-2273235 GGAGCCTCTCTGCTCTGATAAGG No data
985836130_985836141 28 Left 985836130 5:2273184-2273206 CCCTCCACCCTCTGCATGCGGTG No data
Right 985836141 5:2273235-2273257 GGCCAGACGCCATCCCCGGCTGG No data
985836130_985836142 29 Left 985836130 5:2273184-2273206 CCCTCCACCCTCTGCATGCGGTG No data
Right 985836142 5:2273236-2273258 GCCAGACGCCATCCCCGGCTGGG No data
985836130_985836138 7 Left 985836130 5:2273184-2273206 CCCTCCACCCTCTGCATGCGGTG No data
Right 985836138 5:2273214-2273236 GAGCCTCTCTGCTCTGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985836130 Original CRISPR CACCGCATGCAGAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr