ID: 985836931

View in Genome Browser
Species Human (GRCh38)
Location 5:2278376-2278398
Sequence AGCCCTGTAGCCCCTGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985836922_985836931 26 Left 985836922 5:2278327-2278349 CCAGCTCTCAGGACACAGCCCCT No data
Right 985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG No data
985836927_985836931 7 Left 985836927 5:2278346-2278368 CCCTCGTGGTGGGACAGCGCCTG No data
Right 985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG No data
985836921_985836931 27 Left 985836921 5:2278326-2278348 CCCAGCTCTCAGGACACAGCCCC No data
Right 985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG No data
985836926_985836931 8 Left 985836926 5:2278345-2278367 CCCCTCGTGGTGGGACAGCGCCT No data
Right 985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG No data
985836928_985836931 6 Left 985836928 5:2278347-2278369 CCTCGTGGTGGGACAGCGCCTGC No data
Right 985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG No data
985836920_985836931 28 Left 985836920 5:2278325-2278347 CCCCAGCTCTCAGGACACAGCCC No data
Right 985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985836931 Original CRISPR AGCCCTGTAGCCCCTGCACA AGG Intergenic
No off target data available for this crispr