ID: 985838004 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:2284489-2284511 |
| Sequence | ATGATGGCAGCAAAGGCCAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985838004_985838013 | 23 | Left | 985838004 | 5:2284489-2284511 | CCACTGGCCTTTGCTGCCATCAT | No data | ||
| Right | 985838013 | 5:2284535-2284557 | CCCTTGGCTGCTCACCTCAGTGG | No data | ||||
| 985838004_985838009 | 7 | Left | 985838004 | 5:2284489-2284511 | CCACTGGCCTTTGCTGCCATCAT | No data | ||
| Right | 985838009 | 5:2284519-2284541 | AACTCCTGGATATCTCCCCTTGG | No data | ||||
| 985838004_985838007 | -7 | Left | 985838004 | 5:2284489-2284511 | CCACTGGCCTTTGCTGCCATCAT | No data | ||
| Right | 985838007 | 5:2284505-2284527 | CCATCATAGCCTCTAACTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985838004 | Original CRISPR | ATGATGGCAGCAAAGGCCAG TGG (reversed) | Intergenic | ||