ID: 985838004

View in Genome Browser
Species Human (GRCh38)
Location 5:2284489-2284511
Sequence ATGATGGCAGCAAAGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838004_985838013 23 Left 985838004 5:2284489-2284511 CCACTGGCCTTTGCTGCCATCAT No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
985838004_985838009 7 Left 985838004 5:2284489-2284511 CCACTGGCCTTTGCTGCCATCAT No data
Right 985838009 5:2284519-2284541 AACTCCTGGATATCTCCCCTTGG No data
985838004_985838007 -7 Left 985838004 5:2284489-2284511 CCACTGGCCTTTGCTGCCATCAT No data
Right 985838007 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838004 Original CRISPR ATGATGGCAGCAAAGGCCAG TGG (reversed) Intergenic