ID: 985838005

View in Genome Browser
Species Human (GRCh38)
Location 5:2284496-2284518
Sequence AGAGGCTATGATGGCAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838005_985838013 16 Left 985838005 5:2284496-2284518 CCTTTGCTGCCATCATAGCCTCT No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
985838005_985838015 29 Left 985838005 5:2284496-2284518 CCTTTGCTGCCATCATAGCCTCT No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838005_985838009 0 Left 985838005 5:2284496-2284518 CCTTTGCTGCCATCATAGCCTCT No data
Right 985838009 5:2284519-2284541 AACTCCTGGATATCTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838005 Original CRISPR AGAGGCTATGATGGCAGCAA AGG (reversed) Intergenic