ID: 985838005 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:2284496-2284518 |
Sequence | AGAGGCTATGATGGCAGCAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
985838005_985838013 | 16 | Left | 985838005 | 5:2284496-2284518 | CCTTTGCTGCCATCATAGCCTCT | No data | ||
Right | 985838013 | 5:2284535-2284557 | CCCTTGGCTGCTCACCTCAGTGG | No data | ||||
985838005_985838015 | 29 | Left | 985838005 | 5:2284496-2284518 | CCTTTGCTGCCATCATAGCCTCT | No data | ||
Right | 985838015 | 5:2284548-2284570 | ACCTCAGTGGCTTTTCTCAGAGG | No data | ||||
985838005_985838009 | 0 | Left | 985838005 | 5:2284496-2284518 | CCTTTGCTGCCATCATAGCCTCT | No data | ||
Right | 985838009 | 5:2284519-2284541 | AACTCCTGGATATCTCCCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
985838005 | Original CRISPR | AGAGGCTATGATGGCAGCAA AGG (reversed) | Intergenic | ||