ID: 985838006

View in Genome Browser
Species Human (GRCh38)
Location 5:2284505-2284527
Sequence CCAGGAGTTAGAGGCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838006_985838017 24 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838006_985838013 7 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
985838006_985838015 20 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838006_985838009 -9 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838009 5:2284519-2284541 AACTCCTGGATATCTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838006 Original CRISPR CCAGGAGTTAGAGGCTATGA TGG (reversed) Intergenic