ID: 985838008

View in Genome Browser
Species Human (GRCh38)
Location 5:2284514-2284536
Sequence GGGAGATATCCAGGAGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838008_985838015 11 Left 985838008 5:2284514-2284536 CCTCTAACTCCTGGATATCTCCC No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838008_985838017 15 Left 985838008 5:2284514-2284536 CCTCTAACTCCTGGATATCTCCC No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838008_985838013 -2 Left 985838008 5:2284514-2284536 CCTCTAACTCCTGGATATCTCCC No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838008 Original CRISPR GGGAGATATCCAGGAGTTAG AGG (reversed) Intergenic