ID: 985838009

View in Genome Browser
Species Human (GRCh38)
Location 5:2284519-2284541
Sequence AACTCCTGGATATCTCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838004_985838009 7 Left 985838004 5:2284489-2284511 CCACTGGCCTTTGCTGCCATCAT No data
Right 985838009 5:2284519-2284541 AACTCCTGGATATCTCCCCTTGG No data
985838005_985838009 0 Left 985838005 5:2284496-2284518 CCTTTGCTGCCATCATAGCCTCT No data
Right 985838009 5:2284519-2284541 AACTCCTGGATATCTCCCCTTGG No data
985838006_985838009 -9 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838009 5:2284519-2284541 AACTCCTGGATATCTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838009 Original CRISPR AACTCCTGGATATCTCCCCT TGG Intergenic