ID: 985838010

View in Genome Browser
Species Human (GRCh38)
Location 5:2284523-2284545
Sequence GCAGCCAAGGGGAGATATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838010_985838015 2 Left 985838010 5:2284523-2284545 CCTGGATATCTCCCCTTGGCTGC No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838010_985838017 6 Left 985838010 5:2284523-2284545 CCTGGATATCTCCCCTTGGCTGC No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838010_985838018 26 Left 985838010 5:2284523-2284545 CCTGGATATCTCCCCTTGGCTGC No data
Right 985838018 5:2284572-2284594 AGGCTCAGAATTTCAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838010 Original CRISPR GCAGCCAAGGGGAGATATCC AGG (reversed) Intergenic