ID: 985838013

View in Genome Browser
Species Human (GRCh38)
Location 5:2284535-2284557
Sequence CCCTTGGCTGCTCACCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838008_985838013 -2 Left 985838008 5:2284514-2284536 CCTCTAACTCCTGGATATCTCCC No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
985838005_985838013 16 Left 985838005 5:2284496-2284518 CCTTTGCTGCCATCATAGCCTCT No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
985838004_985838013 23 Left 985838004 5:2284489-2284511 CCACTGGCCTTTGCTGCCATCAT No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
985838006_985838013 7 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838013 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838013 Original CRISPR CCCTTGGCTGCTCACCTCAG TGG Intergenic