ID: 985838015

View in Genome Browser
Species Human (GRCh38)
Location 5:2284548-2284570
Sequence ACCTCAGTGGCTTTTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838012_985838015 -10 Left 985838012 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838005_985838015 29 Left 985838005 5:2284496-2284518 CCTTTGCTGCCATCATAGCCTCT No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838006_985838015 20 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838010_985838015 2 Left 985838010 5:2284523-2284545 CCTGGATATCTCCCCTTGGCTGC No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838011_985838015 -9 Left 985838011 5:2284534-2284556 CCCCTTGGCTGCTCACCTCAGTG No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data
985838008_985838015 11 Left 985838008 5:2284514-2284536 CCTCTAACTCCTGGATATCTCCC No data
Right 985838015 5:2284548-2284570 ACCTCAGTGGCTTTTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838015 Original CRISPR ACCTCAGTGGCTTTTCTCAG AGG Intergenic