ID: 985838017

View in Genome Browser
Species Human (GRCh38)
Location 5:2284552-2284574
Sequence CAGTGGCTTTTCTCAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985838014_985838017 -7 Left 985838014 5:2284536-2284558 CCTTGGCTGCTCACCTCAGTGGC No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838011_985838017 -5 Left 985838011 5:2284534-2284556 CCCCTTGGCTGCTCACCTCAGTG No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838006_985838017 24 Left 985838006 5:2284505-2284527 CCATCATAGCCTCTAACTCCTGG No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838012_985838017 -6 Left 985838012 5:2284535-2284557 CCCTTGGCTGCTCACCTCAGTGG No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838010_985838017 6 Left 985838010 5:2284523-2284545 CCTGGATATCTCCCCTTGGCTGC No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data
985838008_985838017 15 Left 985838008 5:2284514-2284536 CCTCTAACTCCTGGATATCTCCC No data
Right 985838017 5:2284552-2284574 CAGTGGCTTTTCTCAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985838017 Original CRISPR CAGTGGCTTTTCTCAGAGGA AGG Intergenic