ID: 985840223

View in Genome Browser
Species Human (GRCh38)
Location 5:2300284-2300306
Sequence CAGCTCTTCTAAGGCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985840214_985840223 11 Left 985840214 5:2300250-2300272 CCATGCCATCGCCTCTTCTGCCA No data
Right 985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG No data
985840211_985840223 26 Left 985840211 5:2300235-2300257 CCCTGAGCCTCAGTTCCATGCCA No data
Right 985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG No data
985840212_985840223 25 Left 985840212 5:2300236-2300258 CCTGAGCCTCAGTTCCATGCCAT No data
Right 985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG No data
985840213_985840223 19 Left 985840213 5:2300242-2300264 CCTCAGTTCCATGCCATCGCCTC No data
Right 985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG No data
985840219_985840223 0 Left 985840219 5:2300261-2300283 CCTCTTCTGCCAGGGGTTGCTTG No data
Right 985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG No data
985840218_985840223 6 Left 985840218 5:2300255-2300277 CCATCGCCTCTTCTGCCAGGGGT No data
Right 985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG No data
985840220_985840223 -9 Left 985840220 5:2300270-2300292 CCAGGGGTTGCTTGCAGCTCTTC No data
Right 985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985840223 Original CRISPR CAGCTCTTCTAAGGCATGGA AGG Intergenic
No off target data available for this crispr