ID: 985847633

View in Genome Browser
Species Human (GRCh38)
Location 5:2364168-2364190
Sequence GACCCAGTCAGTGGTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985847633_985847639 26 Left 985847633 5:2364168-2364190 CCTGTGAGACCACTGACTGGGTC No data
Right 985847639 5:2364217-2364239 GTGCCACTACTGCTCTAAGTGGG No data
985847633_985847638 25 Left 985847633 5:2364168-2364190 CCTGTGAGACCACTGACTGGGTC No data
Right 985847638 5:2364216-2364238 AGTGCCACTACTGCTCTAAGTGG No data
985847633_985847641 30 Left 985847633 5:2364168-2364190 CCTGTGAGACCACTGACTGGGTC No data
Right 985847641 5:2364221-2364243 CACTACTGCTCTAAGTGGGCAGG No data
985847633_985847636 -1 Left 985847633 5:2364168-2364190 CCTGTGAGACCACTGACTGGGTC No data
Right 985847636 5:2364190-2364212 CTGCTATCAGGTAGAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985847633 Original CRISPR GACCCAGTCAGTGGTCTCAC AGG (reversed) Intergenic
No off target data available for this crispr