ID: 985848985

View in Genome Browser
Species Human (GRCh38)
Location 5:2374735-2374757
Sequence GCCCCCATCTCTGCTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985848985_985848988 -8 Left 985848985 5:2374735-2374757 CCTGTGAAAGCAGAGATGGGGGC No data
Right 985848988 5:2374750-2374772 ATGGGGGCCAGGGCTCTATTTGG No data
985848985_985848991 22 Left 985848985 5:2374735-2374757 CCTGTGAAAGCAGAGATGGGGGC No data
Right 985848991 5:2374780-2374802 AAGCTCAAGAAAGCCACCTATGG No data
985848985_985848992 23 Left 985848985 5:2374735-2374757 CCTGTGAAAGCAGAGATGGGGGC No data
Right 985848992 5:2374781-2374803 AGCTCAAGAAAGCCACCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985848985 Original CRISPR GCCCCCATCTCTGCTTTCAC AGG (reversed) Intergenic
No off target data available for this crispr