ID: 985848988

View in Genome Browser
Species Human (GRCh38)
Location 5:2374750-2374772
Sequence ATGGGGGCCAGGGCTCTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985848978_985848988 14 Left 985848978 5:2374713-2374735 CCTGGCCTCCTTTTACGCGGCTC No data
Right 985848988 5:2374750-2374772 ATGGGGGCCAGGGCTCTATTTGG No data
985848985_985848988 -8 Left 985848985 5:2374735-2374757 CCTGTGAAAGCAGAGATGGGGGC No data
Right 985848988 5:2374750-2374772 ATGGGGGCCAGGGCTCTATTTGG No data
985848980_985848988 6 Left 985848980 5:2374721-2374743 CCTTTTACGCGGCTCCTGTGAAA No data
Right 985848988 5:2374750-2374772 ATGGGGGCCAGGGCTCTATTTGG No data
985848975_985848988 18 Left 985848975 5:2374709-2374731 CCCACCTGGCCTCCTTTTACGCG No data
Right 985848988 5:2374750-2374772 ATGGGGGCCAGGGCTCTATTTGG No data
985848976_985848988 17 Left 985848976 5:2374710-2374732 CCACCTGGCCTCCTTTTACGCGG No data
Right 985848988 5:2374750-2374772 ATGGGGGCCAGGGCTCTATTTGG No data
985848979_985848988 9 Left 985848979 5:2374718-2374740 CCTCCTTTTACGCGGCTCCTGTG No data
Right 985848988 5:2374750-2374772 ATGGGGGCCAGGGCTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985848988 Original CRISPR ATGGGGGCCAGGGCTCTATT TGG Intergenic
No off target data available for this crispr