ID: 985848991

View in Genome Browser
Species Human (GRCh38)
Location 5:2374780-2374802
Sequence AAGCTCAAGAAAGCCACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985848985_985848991 22 Left 985848985 5:2374735-2374757 CCTGTGAAAGCAGAGATGGGGGC No data
Right 985848991 5:2374780-2374802 AAGCTCAAGAAAGCCACCTATGG No data
985848989_985848991 0 Left 985848989 5:2374757-2374779 CCAGGGCTCTATTTGGCCTTCGC No data
Right 985848991 5:2374780-2374802 AAGCTCAAGAAAGCCACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985848991 Original CRISPR AAGCTCAAGAAAGCCACCTA TGG Intergenic
No off target data available for this crispr