ID: 985848992

View in Genome Browser
Species Human (GRCh38)
Location 5:2374781-2374803
Sequence AGCTCAAGAAAGCCACCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985848989_985848992 1 Left 985848989 5:2374757-2374779 CCAGGGCTCTATTTGGCCTTCGC No data
Right 985848992 5:2374781-2374803 AGCTCAAGAAAGCCACCTATGGG No data
985848985_985848992 23 Left 985848985 5:2374735-2374757 CCTGTGAAAGCAGAGATGGGGGC No data
Right 985848992 5:2374781-2374803 AGCTCAAGAAAGCCACCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985848992 Original CRISPR AGCTCAAGAAAGCCACCTAT GGG Intergenic
No off target data available for this crispr