ID: 985851711

View in Genome Browser
Species Human (GRCh38)
Location 5:2393298-2393320
Sequence GCTGAAGGATTCGCCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985851711_985851717 -8 Left 985851711 5:2393298-2393320 CCTCCAGAGGCGAATCCTTCAGC No data
Right 985851717 5:2393313-2393335 CCTTCAGCATTCTGTTGTGGGGG No data
985851711_985851715 -9 Left 985851711 5:2393298-2393320 CCTCCAGAGGCGAATCCTTCAGC No data
Right 985851715 5:2393312-2393334 TCCTTCAGCATTCTGTTGTGGGG No data
985851711_985851714 -10 Left 985851711 5:2393298-2393320 CCTCCAGAGGCGAATCCTTCAGC No data
Right 985851714 5:2393311-2393333 ATCCTTCAGCATTCTGTTGTGGG No data
985851711_985851719 19 Left 985851711 5:2393298-2393320 CCTCCAGAGGCGAATCCTTCAGC No data
Right 985851719 5:2393340-2393362 ACGTCTTCCCTGTGGCATCGTGG No data
985851711_985851718 11 Left 985851711 5:2393298-2393320 CCTCCAGAGGCGAATCCTTCAGC No data
Right 985851718 5:2393332-2393354 GGGGATACACGTCTTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985851711 Original CRISPR GCTGAAGGATTCGCCTCTGG AGG (reversed) Intergenic
No off target data available for this crispr