ID: 985851908

View in Genome Browser
Species Human (GRCh38)
Location 5:2394710-2394732
Sequence TTGTATCTAAAGACGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985851903_985851908 24 Left 985851903 5:2394663-2394685 CCAGGTCTACTGTGTGGGTCCAA No data
Right 985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG No data
985851905_985851908 -4 Left 985851905 5:2394691-2394713 CCACGCACCTGTGACGATTTTGT No data
Right 985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG No data
985851904_985851908 5 Left 985851904 5:2394682-2394704 CCAAAACAGCCACGCACCTGTGA No data
Right 985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985851908 Original CRISPR TTGTATCTAAAGACGAAGCT GGG Intergenic
No off target data available for this crispr