ID: 985852207

View in Genome Browser
Species Human (GRCh38)
Location 5:2397175-2397197
Sequence TCCCACTGCCTCCTCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985852205_985852207 -10 Left 985852205 5:2397162-2397184 CCAGTCTCAGTTGTCCCACTGCC No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data
985852201_985852207 13 Left 985852201 5:2397139-2397161 CCTGCCCCTGGGGTAATGGGGAT No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data
985852193_985852207 27 Left 985852193 5:2397125-2397147 CCTGTGTGTCCTCTCCTGCCCCT No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data
985852197_985852207 18 Left 985852197 5:2397134-2397156 CCTCTCCTGCCCCTGGGGTAATG No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data
985852203_985852207 8 Left 985852203 5:2397144-2397166 CCCTGGGGTAATGGGGATCCAGT No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data
985852204_985852207 7 Left 985852204 5:2397145-2397167 CCTGGGGTAATGGGGATCCAGTC No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data
985852192_985852207 28 Left 985852192 5:2397124-2397146 CCCTGTGTGTCCTCTCCTGCCCC No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data
985852202_985852207 9 Left 985852202 5:2397143-2397165 CCCCTGGGGTAATGGGGATCCAG No data
Right 985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985852207 Original CRISPR TCCCACTGCCTCCTCTCCCA GGG Intergenic
No off target data available for this crispr