ID: 985854611

View in Genome Browser
Species Human (GRCh38)
Location 5:2415342-2415364
Sequence ATGCTTACAAGCTGTCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985854611_985854617 6 Left 985854611 5:2415342-2415364 CCCATGTGACAGCTTGTAAGCAT No data
Right 985854617 5:2415371-2415393 CAGGTGTGTGCAGGTGAGCTGGG No data
985854611_985854614 -3 Left 985854611 5:2415342-2415364 CCCATGTGACAGCTTGTAAGCAT No data
Right 985854614 5:2415362-2415384 CATGATTTCCAGGTGTGTGCAGG No data
985854611_985854616 5 Left 985854611 5:2415342-2415364 CCCATGTGACAGCTTGTAAGCAT No data
Right 985854616 5:2415370-2415392 CCAGGTGTGTGCAGGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985854611 Original CRISPR ATGCTTACAAGCTGTCACAT GGG (reversed) Intergenic
No off target data available for this crispr