ID: 985854685

View in Genome Browser
Species Human (GRCh38)
Location 5:2415852-2415874
Sequence TCTCCCTGAATCACCGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985854680_985854685 -10 Left 985854680 5:2415839-2415861 CCCTCCGCGAAGCTCTCCCTGAA No data
Right 985854685 5:2415852-2415874 TCTCCCTGAATCACCGCGCGGGG No data
985854679_985854685 -4 Left 985854679 5:2415833-2415855 CCACTTCCCTCCGCGAAGCTCTC No data
Right 985854685 5:2415852-2415874 TCTCCCTGAATCACCGCGCGGGG No data
985854678_985854685 3 Left 985854678 5:2415826-2415848 CCTGCTGCCACTTCCCTCCGCGA No data
Right 985854685 5:2415852-2415874 TCTCCCTGAATCACCGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985854685 Original CRISPR TCTCCCTGAATCACCGCGCG GGG Intergenic
No off target data available for this crispr