ID: 985855054

View in Genome Browser
Species Human (GRCh38)
Location 5:2417988-2418010
Sequence CCCCATACTCCCATGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985855054_985855065 25 Left 985855054 5:2417988-2418010 CCTTACCCCATGGGAGTATGGGG No data
Right 985855065 5:2418036-2418058 TCTGGGCACAAGAGCTAAACAGG No data
985855054_985855062 7 Left 985855054 5:2417988-2418010 CCTTACCCCATGGGAGTATGGGG No data
Right 985855062 5:2418018-2418040 AGGTTTTGAAGCCTGGGTTCTGG No data
985855054_985855063 8 Left 985855054 5:2417988-2418010 CCTTACCCCATGGGAGTATGGGG No data
Right 985855063 5:2418019-2418041 GGTTTTGAAGCCTGGGTTCTGGG No data
985855054_985855060 0 Left 985855054 5:2417988-2418010 CCTTACCCCATGGGAGTATGGGG No data
Right 985855060 5:2418011-2418033 ACACATGAGGTTTTGAAGCCTGG No data
985855054_985855061 1 Left 985855054 5:2417988-2418010 CCTTACCCCATGGGAGTATGGGG No data
Right 985855061 5:2418012-2418034 CACATGAGGTTTTGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985855054 Original CRISPR CCCCATACTCCCATGGGGTA AGG (reversed) Intergenic
No off target data available for this crispr