ID: 985856117

View in Genome Browser
Species Human (GRCh38)
Location 5:2428913-2428935
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985856117_985856130 23 Left 985856117 5:2428913-2428935 CCTGGGGCCTGCCTATCTCCTCC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856117_985856123 3 Left 985856117 5:2428913-2428935 CCTGGGGCCTGCCTATCTCCTCC No data
Right 985856123 5:2428939-2428961 ATTCTCCAGGACCTCTGCCAAGG No data
985856117_985856125 5 Left 985856117 5:2428913-2428935 CCTGGGGCCTGCCTATCTCCTCC No data
Right 985856125 5:2428941-2428963 TCTCCAGGACCTCTGCCAAGGGG No data
985856117_985856120 -10 Left 985856117 5:2428913-2428935 CCTGGGGCCTGCCTATCTCCTCC No data
Right 985856120 5:2428926-2428948 TATCTCCTCCAGAATTCTCCAGG No data
985856117_985856129 22 Left 985856117 5:2428913-2428935 CCTGGGGCCTGCCTATCTCCTCC No data
Right 985856129 5:2428958-2428980 AAGGGGAAGCCACTTTGAAGAGG No data
985856117_985856124 4 Left 985856117 5:2428913-2428935 CCTGGGGCCTGCCTATCTCCTCC No data
Right 985856124 5:2428940-2428962 TTCTCCAGGACCTCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985856117 Original CRISPR GGAGGAGATAGGCAGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr