ID: 985856118

View in Genome Browser
Species Human (GRCh38)
Location 5:2428920-2428942
Sequence GAATTCTGGAGGAGATAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985856118_985856132 27 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856132 5:2428970-2428992 CTTTGAAGAGGGTCCTCATCAGG No data
985856118_985856130 16 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856118_985856133 28 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856133 5:2428971-2428993 TTTGAAGAGGGTCCTCATCAGGG No data
985856118_985856123 -4 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856123 5:2428939-2428961 ATTCTCCAGGACCTCTGCCAAGG No data
985856118_985856124 -3 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856124 5:2428940-2428962 TTCTCCAGGACCTCTGCCAAGGG No data
985856118_985856125 -2 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856125 5:2428941-2428963 TCTCCAGGACCTCTGCCAAGGGG No data
985856118_985856134 29 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856134 5:2428972-2428994 TTGAAGAGGGTCCTCATCAGGGG No data
985856118_985856129 15 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856129 5:2428958-2428980 AAGGGGAAGCCACTTTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985856118 Original CRISPR GAATTCTGGAGGAGATAGGC AGG (reversed) Intergenic
No off target data available for this crispr