ID: 985856121

View in Genome Browser
Species Human (GRCh38)
Location 5:2428931-2428953
Sequence GAGGTCCTGGAGAATTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985856121_985856134 18 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856134 5:2428972-2428994 TTGAAGAGGGTCCTCATCAGGGG No data
985856121_985856133 17 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856133 5:2428971-2428993 TTTGAAGAGGGTCCTCATCAGGG No data
985856121_985856130 5 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856121_985856135 27 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856135 5:2428981-2429003 GTCCTCATCAGGGGTTCTGCAGG No data
985856121_985856138 29 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856138 5:2428983-2429005 CCTCATCAGGGGTTCTGCAGGGG No data
985856121_985856136 28 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856136 5:2428982-2429004 TCCTCATCAGGGGTTCTGCAGGG No data
985856121_985856132 16 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856132 5:2428970-2428992 CTTTGAAGAGGGTCCTCATCAGG No data
985856121_985856129 4 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856129 5:2428958-2428980 AAGGGGAAGCCACTTTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985856121 Original CRISPR GAGGTCCTGGAGAATTCTGG AGG (reversed) Intergenic
No off target data available for this crispr