ID: 985856130

View in Genome Browser
Species Human (GRCh38)
Location 5:2428959-2428981
Sequence AGGGGAAGCCACTTTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985856121_985856130 5 Left 985856121 5:2428931-2428953 CCTCCAGAATTCTCCAGGACCTC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856126_985856130 -8 Left 985856126 5:2428944-2428966 CCAGGACCTCTGCCAAGGGGAAG No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856116_985856130 24 Left 985856116 5:2428912-2428934 CCCTGGGGCCTGCCTATCTCCTC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856117_985856130 23 Left 985856117 5:2428913-2428935 CCTGGGGCCTGCCTATCTCCTCC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856122_985856130 2 Left 985856122 5:2428934-2428956 CCAGAATTCTCCAGGACCTCTGC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856118_985856130 16 Left 985856118 5:2428920-2428942 CCTGCCTATCTCCTCCAGAATTC No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data
985856119_985856130 12 Left 985856119 5:2428924-2428946 CCTATCTCCTCCAGAATTCTCCA No data
Right 985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985856130 Original CRISPR AGGGGAAGCCACTTTGAAGA GGG Intergenic
No off target data available for this crispr