ID: 985859422

View in Genome Browser
Species Human (GRCh38)
Location 5:2458793-2458815
Sequence CACGCACACACAATGTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985859421_985859422 27 Left 985859421 5:2458743-2458765 CCTAATTAAACACACGCACACAC No data
Right 985859422 5:2458793-2458815 CACGCACACACAATGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985859422 Original CRISPR CACGCACACACAATGTTTTC TGG Intergenic
No off target data available for this crispr