ID: 985860136

View in Genome Browser
Species Human (GRCh38)
Location 5:2464358-2464380
Sequence GTGCAAACCCACATGTTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985860128_985860136 23 Left 985860128 5:2464312-2464334 CCGGACGCTTGGGACCACGGAGC No data
Right 985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG No data
985860134_985860136 -8 Left 985860134 5:2464343-2464365 CCTCCGTGGACGTGAGTGCAAAC No data
Right 985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG No data
985860132_985860136 0 Left 985860132 5:2464335-2464357 CCACATGCCCTCCGTGGACGTGA No data
Right 985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG No data
985860129_985860136 9 Left 985860129 5:2464326-2464348 CCACGGAGCCCACATGCCCTCCG No data
Right 985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG No data
985860127_985860136 24 Left 985860127 5:2464311-2464333 CCCGGACGCTTGGGACCACGGAG No data
Right 985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG No data
985860133_985860136 -7 Left 985860133 5:2464342-2464364 CCCTCCGTGGACGTGAGTGCAAA No data
Right 985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG No data
985860131_985860136 1 Left 985860131 5:2464334-2464356 CCCACATGCCCTCCGTGGACGTG No data
Right 985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985860136 Original CRISPR GTGCAAACCCACATGTTCAT TGG Intergenic
No off target data available for this crispr