ID: 985863548

View in Genome Browser
Species Human (GRCh38)
Location 5:2493786-2493808
Sequence GCACCTGCTCCTGGTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985863545_985863548 -2 Left 985863545 5:2493765-2493787 CCTGTGTTTCTAGGCATGTGTGC No data
Right 985863548 5:2493786-2493808 GCACCTGCTCCTGGTGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985863548 Original CRISPR GCACCTGCTCCTGGTGCTAT GGG Intergenic
No off target data available for this crispr