ID: 985863658

View in Genome Browser
Species Human (GRCh38)
Location 5:2494800-2494822
Sequence CTTCTGAGGGACACCGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985863658_985863666 26 Left 985863658 5:2494800-2494822 CCTTTCACGGTGTCCCTCAGAAG No data
Right 985863666 5:2494849-2494871 GACACAGCTGCTGTGGTGTCTGG No data
985863658_985863665 19 Left 985863658 5:2494800-2494822 CCTTTCACGGTGTCCCTCAGAAG No data
Right 985863665 5:2494842-2494864 GAAACAAGACACAGCTGCTGTGG No data
985863658_985863667 27 Left 985863658 5:2494800-2494822 CCTTTCACGGTGTCCCTCAGAAG No data
Right 985863667 5:2494850-2494872 ACACAGCTGCTGTGGTGTCTGGG No data
985863658_985863668 30 Left 985863658 5:2494800-2494822 CCTTTCACGGTGTCCCTCAGAAG No data
Right 985863668 5:2494853-2494875 CAGCTGCTGTGGTGTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985863658 Original CRISPR CTTCTGAGGGACACCGTGAA AGG (reversed) Intergenic
No off target data available for this crispr