ID: 985863914

View in Genome Browser
Species Human (GRCh38)
Location 5:2496396-2496418
Sequence ACTCCCAGCTTCCAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985863909_985863914 -1 Left 985863909 5:2496374-2496396 CCTGCCAGCACCCTGGTCTCCGA No data
Right 985863914 5:2496396-2496418 ACTCCCAGCTTCCAGAGCCCTGG No data
985863908_985863914 0 Left 985863908 5:2496373-2496395 CCCTGCCAGCACCCTGGTCTCCG No data
Right 985863914 5:2496396-2496418 ACTCCCAGCTTCCAGAGCCCTGG No data
985863905_985863914 16 Left 985863905 5:2496357-2496379 CCCTCTGTGGAACTCGCCCTGCC No data
Right 985863914 5:2496396-2496418 ACTCCCAGCTTCCAGAGCCCTGG No data
985863906_985863914 15 Left 985863906 5:2496358-2496380 CCTCTGTGGAACTCGCCCTGCCA No data
Right 985863914 5:2496396-2496418 ACTCCCAGCTTCCAGAGCCCTGG No data
985863910_985863914 -5 Left 985863910 5:2496378-2496400 CCAGCACCCTGGTCTCCGACTCC No data
Right 985863914 5:2496396-2496418 ACTCCCAGCTTCCAGAGCCCTGG No data
985863904_985863914 27 Left 985863904 5:2496346-2496368 CCAGGAGGAGGCCCTCTGTGGAA No data
Right 985863914 5:2496396-2496418 ACTCCCAGCTTCCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985863914 Original CRISPR ACTCCCAGCTTCCAGAGCCC TGG Intergenic