ID: 985864102

View in Genome Browser
Species Human (GRCh38)
Location 5:2498657-2498679
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985864102_985864108 3 Left 985864102 5:2498657-2498679 CCCAGATACAAGTGCTGACCCTG No data
Right 985864108 5:2498683-2498705 TCCGAACCCATGCTGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985864102 Original CRISPR CAGGGTCAGCACTTGTATCT GGG (reversed) Intergenic
No off target data available for this crispr