ID: 985864568

View in Genome Browser
Species Human (GRCh38)
Location 5:2504326-2504348
Sequence CACATGATACAGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985864568_985864574 22 Left 985864568 5:2504326-2504348 CCTTCCACCCTCTGTATCATGTG No data
Right 985864574 5:2504371-2504393 TCGCCAGACATTGAACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985864568 Original CRISPR CACATGATACAGAGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr