ID: 985865089

View in Genome Browser
Species Human (GRCh38)
Location 5:2508525-2508547
Sequence GGAGATGCTTTAAAAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985865089_985865094 30 Left 985865089 5:2508525-2508547 CCTGAGCTTTTTAAAGCATCTCC No data
Right 985865094 5:2508578-2508600 GAAATACATCCCCGACACTCAGG No data
985865089_985865091 7 Left 985865089 5:2508525-2508547 CCTGAGCTTTTTAAAGCATCTCC No data
Right 985865091 5:2508555-2508577 GAAGCCTGACACTTAGTACATGG No data
985865089_985865092 8 Left 985865089 5:2508525-2508547 CCTGAGCTTTTTAAAGCATCTCC No data
Right 985865092 5:2508556-2508578 AAGCCTGACACTTAGTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985865089 Original CRISPR GGAGATGCTTTAAAAAGCTC AGG (reversed) Intergenic