ID: 985865090

View in Genome Browser
Species Human (GRCh38)
Location 5:2508546-2508568
Sequence AAGTGTCAGGCTTCTCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985865090_985865094 9 Left 985865090 5:2508546-2508568 CCATACTGAGAAGCCTGACACTT No data
Right 985865094 5:2508578-2508600 GAAATACATCCCCGACACTCAGG No data
985865090_985865099 25 Left 985865090 5:2508546-2508568 CCATACTGAGAAGCCTGACACTT No data
Right 985865099 5:2508594-2508616 ACTCAGGAGCCTGGTGTCACTGG No data
985865090_985865100 26 Left 985865090 5:2508546-2508568 CCATACTGAGAAGCCTGACACTT No data
Right 985865100 5:2508595-2508617 CTCAGGAGCCTGGTGTCACTGGG No data
985865090_985865095 16 Left 985865090 5:2508546-2508568 CCATACTGAGAAGCCTGACACTT No data
Right 985865095 5:2508585-2508607 ATCCCCGACACTCAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985865090 Original CRISPR AAGTGTCAGGCTTCTCAGTA TGG (reversed) Intergenic