ID: 985865093

View in Genome Browser
Species Human (GRCh38)
Location 5:2508559-2508581
Sequence TTTCCCATGTACTAAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985865093_985865099 12 Left 985865093 5:2508559-2508581 CCTGACACTTAGTACATGGGAAA No data
Right 985865099 5:2508594-2508616 ACTCAGGAGCCTGGTGTCACTGG No data
985865093_985865095 3 Left 985865093 5:2508559-2508581 CCTGACACTTAGTACATGGGAAA No data
Right 985865095 5:2508585-2508607 ATCCCCGACACTCAGGAGCCTGG No data
985865093_985865094 -4 Left 985865093 5:2508559-2508581 CCTGACACTTAGTACATGGGAAA No data
Right 985865094 5:2508578-2508600 GAAATACATCCCCGACACTCAGG No data
985865093_985865100 13 Left 985865093 5:2508559-2508581 CCTGACACTTAGTACATGGGAAA No data
Right 985865100 5:2508595-2508617 CTCAGGAGCCTGGTGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985865093 Original CRISPR TTTCCCATGTACTAAGTGTC AGG (reversed) Intergenic