ID: 985865094 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:2508578-2508600 |
| Sequence | GAAATACATCCCCGACACTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985865090_985865094 | 9 | Left | 985865090 | 5:2508546-2508568 | CCATACTGAGAAGCCTGACACTT | No data | ||
| Right | 985865094 | 5:2508578-2508600 | GAAATACATCCCCGACACTCAGG | No data | ||||
| 985865089_985865094 | 30 | Left | 985865089 | 5:2508525-2508547 | CCTGAGCTTTTTAAAGCATCTCC | No data | ||
| Right | 985865094 | 5:2508578-2508600 | GAAATACATCCCCGACACTCAGG | No data | ||||
| 985865093_985865094 | -4 | Left | 985865093 | 5:2508559-2508581 | CCTGACACTTAGTACATGGGAAA | No data | ||
| Right | 985865094 | 5:2508578-2508600 | GAAATACATCCCCGACACTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985865094 | Original CRISPR | GAAATACATCCCCGACACTC AGG | Intergenic | ||