ID: 985865094

View in Genome Browser
Species Human (GRCh38)
Location 5:2508578-2508600
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985865090_985865094 9 Left 985865090 5:2508546-2508568 CCATACTGAGAAGCCTGACACTT No data
Right 985865094 5:2508578-2508600 GAAATACATCCCCGACACTCAGG No data
985865089_985865094 30 Left 985865089 5:2508525-2508547 CCTGAGCTTTTTAAAGCATCTCC No data
Right 985865094 5:2508578-2508600 GAAATACATCCCCGACACTCAGG No data
985865093_985865094 -4 Left 985865093 5:2508559-2508581 CCTGACACTTAGTACATGGGAAA No data
Right 985865094 5:2508578-2508600 GAAATACATCCCCGACACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type