ID: 985865094 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:2508578-2508600 |
Sequence | GAAATACATCCCCGACACTC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
985865090_985865094 | 9 | Left | 985865090 | 5:2508546-2508568 | CCATACTGAGAAGCCTGACACTT | No data | ||
Right | 985865094 | 5:2508578-2508600 | GAAATACATCCCCGACACTCAGG | No data | ||||
985865089_985865094 | 30 | Left | 985865089 | 5:2508525-2508547 | CCTGAGCTTTTTAAAGCATCTCC | No data | ||
Right | 985865094 | 5:2508578-2508600 | GAAATACATCCCCGACACTCAGG | No data | ||||
985865093_985865094 | -4 | Left | 985865093 | 5:2508559-2508581 | CCTGACACTTAGTACATGGGAAA | No data | ||
Right | 985865094 | 5:2508578-2508600 | GAAATACATCCCCGACACTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
985865094 | Original CRISPR | GAAATACATCCCCGACACTC AGG | Intergenic | ||