ID: 985865095

View in Genome Browser
Species Human (GRCh38)
Location 5:2508585-2508607
Sequence ATCCCCGACACTCAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985865090_985865095 16 Left 985865090 5:2508546-2508568 CCATACTGAGAAGCCTGACACTT No data
Right 985865095 5:2508585-2508607 ATCCCCGACACTCAGGAGCCTGG No data
985865093_985865095 3 Left 985865093 5:2508559-2508581 CCTGACACTTAGTACATGGGAAA No data
Right 985865095 5:2508585-2508607 ATCCCCGACACTCAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985865095 Original CRISPR ATCCCCGACACTCAGGAGCC TGG Intergenic
No off target data available for this crispr