ID: 985865100

View in Genome Browser
Species Human (GRCh38)
Location 5:2508595-2508617
Sequence CTCAGGAGCCTGGTGTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985865093_985865100 13 Left 985865093 5:2508559-2508581 CCTGACACTTAGTACATGGGAAA No data
Right 985865100 5:2508595-2508617 CTCAGGAGCCTGGTGTCACTGGG No data
985865090_985865100 26 Left 985865090 5:2508546-2508568 CCATACTGAGAAGCCTGACACTT No data
Right 985865100 5:2508595-2508617 CTCAGGAGCCTGGTGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985865100 Original CRISPR CTCAGGAGCCTGGTGTCACT GGG Intergenic