ID: 985866097

View in Genome Browser
Species Human (GRCh38)
Location 5:2515747-2515769
Sequence AGAGCCTGCGGTCAGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985866097_985866106 4 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866106 5:2515774-2515796 TGGGTGGGAACAGGCCTCGGTGG No data
985866097_985866113 29 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866113 5:2515799-2515821 GCTCTGCGGCTCGGGTCCCAGGG No data
985866097_985866105 1 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866105 5:2515771-2515793 AAGTGGGTGGGAACAGGCCTCGG No data
985866097_985866110 20 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866110 5:2515790-2515812 TCGGTGGGCGCTCTGCGGCTCGG No data
985866097_985866107 5 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866107 5:2515775-2515797 GGGTGGGAACAGGCCTCGGTGGG No data
985866097_985866108 15 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866108 5:2515785-2515807 AGGCCTCGGTGGGCGCTCTGCGG No data
985866097_985866112 28 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866112 5:2515798-2515820 CGCTCTGCGGCTCGGGTCCCAGG No data
985866097_985866104 -5 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866104 5:2515765-2515787 GCTCTGAAGTGGGTGGGAACAGG No data
985866097_985866111 21 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866111 5:2515791-2515813 CGGTGGGCGCTCTGCGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985866097 Original CRISPR AGAGCCTGCGGTCAGTGCCA GGG (reversed) Intergenic