ID: 985866098

View in Genome Browser
Species Human (GRCh38)
Location 5:2515748-2515770
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985866098_985866113 28 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866113 5:2515799-2515821 GCTCTGCGGCTCGGGTCCCAGGG No data
985866098_985866106 3 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866106 5:2515774-2515796 TGGGTGGGAACAGGCCTCGGTGG No data
985866098_985866112 27 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866112 5:2515798-2515820 CGCTCTGCGGCTCGGGTCCCAGG No data
985866098_985866111 20 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866111 5:2515791-2515813 CGGTGGGCGCTCTGCGGCTCGGG No data
985866098_985866105 0 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866105 5:2515771-2515793 AAGTGGGTGGGAACAGGCCTCGG No data
985866098_985866110 19 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866110 5:2515790-2515812 TCGGTGGGCGCTCTGCGGCTCGG No data
985866098_985866104 -6 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866104 5:2515765-2515787 GCTCTGAAGTGGGTGGGAACAGG No data
985866098_985866107 4 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866107 5:2515775-2515797 GGGTGGGAACAGGCCTCGGTGGG No data
985866098_985866108 14 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866108 5:2515785-2515807 AGGCCTCGGTGGGCGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985866098 Original CRISPR CAGAGCCTGCGGTCAGTGCC AGG (reversed) Intergenic