ID: 985866102

View in Genome Browser
Species Human (GRCh38)
Location 5:2515759-2515781
Sequence CCCACCCACTTCAGAGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985866102_985866115 30 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866115 5:2515812-2515834 GGTCCCAGGGTGCACATCCTGGG No data
985866102_985866110 8 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866110 5:2515790-2515812 TCGGTGGGCGCTCTGCGGCTCGG No data
985866102_985866114 29 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866114 5:2515811-2515833 GGGTCCCAGGGTGCACATCCTGG No data
985866102_985866112 16 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866112 5:2515798-2515820 CGCTCTGCGGCTCGGGTCCCAGG No data
985866102_985866107 -7 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866107 5:2515775-2515797 GGGTGGGAACAGGCCTCGGTGGG No data
985866102_985866111 9 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866111 5:2515791-2515813 CGGTGGGCGCTCTGCGGCTCGGG No data
985866102_985866113 17 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866113 5:2515799-2515821 GCTCTGCGGCTCGGGTCCCAGGG No data
985866102_985866108 3 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866108 5:2515785-2515807 AGGCCTCGGTGGGCGCTCTGCGG No data
985866102_985866106 -8 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866106 5:2515774-2515796 TGGGTGGGAACAGGCCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985866102 Original CRISPR CCCACCCACTTCAGAGCCTG CGG (reversed) Intergenic