ID: 985866104

View in Genome Browser
Species Human (GRCh38)
Location 5:2515765-2515787
Sequence GCTCTGAAGTGGGTGGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985866097_985866104 -5 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866104 5:2515765-2515787 GCTCTGAAGTGGGTGGGAACAGG No data
985866098_985866104 -6 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866104 5:2515765-2515787 GCTCTGAAGTGGGTGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985866104 Original CRISPR GCTCTGAAGTGGGTGGGAAC AGG Intergenic