ID: 985866105

View in Genome Browser
Species Human (GRCh38)
Location 5:2515771-2515793
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985866098_985866105 0 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866105 5:2515771-2515793 AAGTGGGTGGGAACAGGCCTCGG No data
985866097_985866105 1 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866105 5:2515771-2515793 AAGTGGGTGGGAACAGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type