ID: 985866106

View in Genome Browser
Species Human (GRCh38)
Location 5:2515774-2515796
Sequence TGGGTGGGAACAGGCCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985866097_985866106 4 Left 985866097 5:2515747-2515769 CCCTGGCACTGACCGCAGGCTCT No data
Right 985866106 5:2515774-2515796 TGGGTGGGAACAGGCCTCGGTGG No data
985866098_985866106 3 Left 985866098 5:2515748-2515770 CCTGGCACTGACCGCAGGCTCTG No data
Right 985866106 5:2515774-2515796 TGGGTGGGAACAGGCCTCGGTGG No data
985866102_985866106 -8 Left 985866102 5:2515759-2515781 CCGCAGGCTCTGAAGTGGGTGGG No data
Right 985866106 5:2515774-2515796 TGGGTGGGAACAGGCCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985866106 Original CRISPR TGGGTGGGAACAGGCCTCGG TGG Intergenic